EST details — SGN-E226974

Search information 
Request: 226974Match: SGN-E226974
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C17599Clone name: cLED-1-G1
cartOrder Clone
Library Name: cLEDOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: ovary
Development Stage: 5 days pre-anthesis to 5 days post-anthesis

Microarray: This clone is not found on any microarray
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C17599 [cLED-1-G1] Trace: SGN-T48487 EST: SGN-E226975 Direction: 3' Facility: TIGR
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E226974Length: 380 bp (800 bp untrimmed)
Status: Current VersionDirection: 5' [See links to 3' reads above]
>SGN-E226974 [] (trimmed) GTTTATTATCATTTATATCCCAATCTGAAAGCCTCTACAAGTCCACATTCTCCTATTGTTTGCCCAGTTACAAATCTCCCAATTTTTCTGGCACA
CTTAGATTAGGCCCAAAAGGCCAGCCACTGAGGATTAAAACCACACCATTGCTAAGAAACCCAAGGAGATCATCCTTTTACTATGTCAATTTAGT
CGGAGTTAAAGTCGGAAAACGAATCGTCGATATCCCTCCCAGTGCATTCGCTTTCGATTCCAACACCGGCGCCGGCACAATAATCGATTCCGGCA
CTGTGTTTACCAGACTCGTTGACCAAACTTACACGGCGGTGAGAAATGAATTCAAGAGGAGAATGGGGAGGAACGCGACGGTGACATCACTTGGT
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E226974] SGN-U582837 Tomato 200607 Build 2 15 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T48486 [Download] [View] Facility Assigned ID: TOVAA37TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.985 Expected Error Rate: 0.0083 Quality Trim Threshold: 14.5