EST details — SGN-E227040

Search information 
Request: 227040Match: SGN-E227040
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C17640Clone name: cLED-1-L6
cartOrder Clone
Library Name: cLEDOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: ovary
Development Stage: 5 days pre-anthesis to 5 days post-anthesis

Microarray: This clone is not found on any microarray
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C17640 [cLED-1-L6] Trace: SGN-T48551 EST: SGN-E227039 Direction: 5' Facility: TIGR
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E227040Length: 466 bp (810 bp untrimmed)
Status: Current VersionDirection: 3' [See links to 5' reads above]
>SGN-E227040 [] (trimmed) GGTGGAACGTAGCAAATATCTCCTGAAATTAGTCAAGGGGCATACAAAAAACTAGAAAGTCGGGAAAATCATTCGAAAATTTCAGCACACATTAG
TAAGCTGCTCCAAGATTACAAACCATGAAAAATAATTCCATAGTTGGCATTCAATACAAGCAGCACATTTAAATCCTGCCATGATAAAGTACATC
TAGTGTACAAGTTGGTTCTGGAAAAACTTTCAAAAGCTAAGCAATCAGTTACAACCTGGATACAGTGTTGATCCTAACTGAAATAGATTAAAAGA
TTACTTTCGTAGAGGAGATGAGAAAGCTGCATAGATAGGGCAAAAGCTCGAATTTGATGTAATATTCATTCATGAGTTCGTCCCTTCTCATGCTT
GGGTAGTGCGGTACAGTGAGGCTAATTCTGACTCTAATGCACAAGCAACGTGGACAAACGATTGAGCTAGTAAACGTAAGGTAAGA
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E227040] SGN-U582281 Tomato 200607 Build 2 19 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T48552 [Download] [View] Facility Assigned ID: TOVAD63TV
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 3' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.960 Expected Error Rate: 0.0080 Quality Trim Threshold: 14.5