Notice: After server upgrades, BLAST should be back now. Apologies for any inconvenience.

EST details — SGN-E227074

Search information 
Request: 227074Match: SGN-E227074
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C17542Clone name: cLED-1-A15
cartOrder Clone
Library Name: cLEDOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: ovary
Development Stage: 5 days pre-anthesis to 5 days post-anthesis

Microarray: This clone is not found on any microarray
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C17542 [cLED-1-A15] Trace: SGN-T48585 EST: SGN-E227073 Direction: 5' Facility: TIGR
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E227074Length: 514 bp (830 bp untrimmed)
Status: Current VersionDirection: 3' [See links to 5' reads above]
>SGN-E227074 [] (trimmed) GAGAAGTGAAATGAAGCTTACTGATAATTTGAATTCATAATAGGGTCTTGTACAGTAACTGCAGCTACAATTCAAATATATGAAGCTAGGACTTA
AAAAGATGTCAAAAAGGTCTACACTTGTTGTAGTTCAGTTGAAACCGCGAAAACAACATCTAGGTCTCTAACTCTATAAATTACTGTCCACAACA
TGAACATTGATAATAAGCTAGGCCGTTCTGTCTCACTAATGAATCTTGAGTGGAAAACGCTGATCGTACACTCCTTGTGGCAATGAGCTAATCCT
AATACCAGATCAGCCAGCAACTCCCATTCACTAATATCCTTTCAACTTGAGTGAAGCAAGTGGAATTCTACTTCCCGGAGGCACGAAAAGTTTCT
TAAAACTGAAGGAATCTATGTTGTATAGCAGGTTTTGAGAAAAGTACCAGAAGTCATAGATTACACAGATACATGTCAGATCAGGGTCCAACGAG
GATAGCAATACTTTCCAACGTAAAGTCGTAGTACTCCTT
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E227074] SGN-U564509 Tomato 200607 Build 2 20 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T48586 [Download] [View] Facility Assigned ID: TOVAA08TV
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 3' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.964 Expected Error Rate: 0.0043 Quality Trim Threshold: 14.5