EST details — SGN-E227118

Search information 
Request: 227118Match: SGN-E227118
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C17601Clone name: cLED-1-H10
cartOrder Clone
Library Name: cLEDOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: ovary
Development Stage: 5 days pre-anthesis to 5 days post-anthesis

Microarray: Alias clone SGN-C181069 is on microarray TOM1: SGN-S1-1-6.1.15.16
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C17601 [cLED-1-H10] Trace: SGN-T48631 EST: SGN-E227119 Direction: 3' Facility: TIGR
Clone: SGN-C181069 [TUS-36-A3] Trace: SGN-T1667 EST: SGN-E378587 Direction: 5' Facility: Giov. Lab
Clone: SGN-C181069 [TUS-36-A3] Trace: SGN-T187608 EST: SGN-E375050 Direction: 3' Facility: INRA
Clone: SGN-C181069 [TUS-36-A3] Trace: SGN-T187609 EST: SGN-E375051 Direction: 5' Facility: INRA
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E227118Length: 415 bp (773 bp untrimmed)
Status: Current VersionDirection: 5' [See links to 3' reads above]
>SGN-E227118 [] (trimmed) TAGATTCAACGAATTCTCTGGGAGCATTCCTCCAAGTATATGTCAGCTTCAATCTATTCAGATACTGGACCTTTCTAGCAATCGTATATCAGGAA
GAATTCCGAAATGCCTCAGCAATTTCACCACAATGCAACTGTTGCTAGATGGTTCAAGTGTGAGCTATGACTTCGATCCATACACCGCTCGAGTA
GGTACACTGTACCATGGCAATGCATTAGTCCAATGGAAAAACAAGGAGTCAGAGTATCGCAACATCTTGTGGCTTCTGAAAACCATCGATCTGTC
TAGCAACGAACTAGTCGGTGACATCCCAAATGATTTTAGCAGAATGAATGCATTGCTGTCATTGAACCTATCAAGGAACAATTCGTCGGGAAGTG
TCATTGAAGGAATTGGTTTAATGAAGATGTTGGAG
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E227118] SGN-U562726 Tomato 200607 Build 2 5 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T48630 [Download] [View] Facility Assigned ID: TOVAD41TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.981 Expected Error Rate: 0.0154 Quality Trim Threshold: 14.5