Notice: The SGN server will be upgraded later today. SGN may be intermittently unavailable during the upgrade. We apologize for any inconvenience.

EST details — SGN-E228100

Search information 
Request: 228100Match: SGN-E228100
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C20511Clone name: cLED-2-L9
cartOrder Clone
Library Name: cLEDOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: ovary
Development Stage: 5 days pre-anthesis to 5 days post-anthesis

Microarray: Alias clone SGN-C182237 is on microarray TOM1: SGN-S1-1-6.1.8.21
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
No additional reads found.
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E228100Length: 322 bp (775 bp untrimmed)
Status: Current VersionDirection: 5'
>SGN-E228100 [] (trimmed) AGTAGCAAGGTAGTGAAGTTGTGTGACCTAGGAATTGATGATAGTGTTAGTTCAGTTGGTTGGGCACAACGGGGCACGCATCTAGCTGTTGGAAC
AAGTAATGGCAAAGTCCAGTTATGGGATTCCTCGCGCTGTAAGAGGATAAGAACCATGGAGGGTCATCGATTACGAGTTGGCGCACTTGCGTGGA
GCTCATCCATGCTGTCTTCAGGAAGCCGAGACAAGAGTATTCTTCAGCGTGATATACGTGCTCAAGAAGATTTTGTCAGTAAGCTGAGTGGTCAT
AAATCAGAGGTTTTGGGGGCTCAAATGGTCTTATGAT
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E228100] SGN-U570015 Tomato 200607 Build 2 10 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T48748 [Download] [View] Facility Assigned ID: TOVAG65TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.972 Expected Error Rate: 0.0261 Quality Trim Threshold: 14.5