EST details — SGN-E228264

Search information 
Request: 228264Match: SGN-E228264
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C20357Clone name: cLED-2-D24
cartOrder Clone
Library Name: cLEDOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: ovary
Development Stage: 5 days pre-anthesis to 5 days post-anthesis

Microarray: This clone is not found on any microarray
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C168989 [TUS-4-I19] Trace: SGN-T191172 EST: SGN-E389846 Direction: 5' Facility: Avesthagen
Clone: SGN-C168989 [TUS-4-I19] Trace: SGN-T191353 EST: SGN-E390027 Direction: 3' Facility: Avesthagen
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E228264Length: 528 bp (811 bp untrimmed)
Status: Current VersionDirection: 5' [See links to 3' reads above]
>SGN-E228264 [] (trimmed) CAGGTGGAACGGGTCAGATTATTCCAACTGCACGACGTGTAGCCTACTCTGCTTTTCTTATGGCAACACCCAGACTTATGGAACCTGTGTATTAT
GTGGAGATCCAAACGCCCATGGATTGTCTCTCTGCTATATACACCGTGTTGTCACGTAGGCGTGGACACGTTACTGCTGATGTTCCTCAACCTGG
CACCCCTGCCTACATTGTCAAGGCATTTTTACCCGTTATCGAGTCCTTTGGTTTTGAAACGGACTTGAGGTATCACACCCAAGGGCAGGCGTTTT
GTCTTTCAGTATTTGATCATTGGGCTATTGTCCCCGGGGATCCTCTTGACAAGAGCATCGTTCTACGACCACTGGAGCCTGCTCCAATCCAACAT
CTGGCTCGTGAGTTCATGGTGAAGACAAGGCGTAGAAAGGGAATGAGTGAAGATGTGAGCATCAACAAGTTCTTTGATGAAGCTATGATGGTGGA
GCTTGCGCAGCAGGATGCTGATCTTCACCTGCAGATGATGTAGATATGTAGTT
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E228264] SGN-U576416 Tomato 200607 Build 2 13 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T48912 [Download] [View] Facility Assigned ID: TOVAH24TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.984 Expected Error Rate: 0.0021 Quality Trim Threshold: 14.5