EST details — SGN-E228535

Search information 
Request: 228535Match: SGN-E228535
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C22908Clone name: cLED-3-P16
cartOrder Clone
Library Name: cLEDOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: ovary
Development Stage: 5 days pre-anthesis to 5 days post-anthesis

Microarray: Alias clone SGN-C181137 is on microarray TOM1: SGN-S1-1-2.3.14.3
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C181137 [TUS-36-C23] Trace: SGN-T187626 EST: SGN-E375068 Direction: 5' Facility: INRA
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E228535Length: 368 bp (822 bp untrimmed)
Status: Current VersionDirection: 5'
>SGN-E228535 [] (trimmed) GCAAAGAAGTAAAAACAGAGATAAATTTTAGAAGGAAAATAAATCAGAATGAGTTCAAGCAGAAGAGCGTGGATAGTAGCAGCCAGTGTTGGAGC
AGTAGAGGCCTTAAAAGATCAAGTTGGATTGTGTAGATGGAATTACCCATTGAGGTCTTTGGCACAACACACAAAGAATAACGTGAGATCTTATT
CTCAAGCTAAGAAACTTTCTTCTTCAATAACTACAAAGAGTGAGAAGATGGAGAAATCTGAAGAATCATTGAGAAAAGTTATGTATTTGAGCTGT
TGGGGTCCAAATTGATTGTAATTAAATAGGATTACTCTGTATTTCGAAAATTATATCAGAAAACTGCAATACATTGTGTTGAT
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E228535] SGN-U579880 Tomato 200607 Build 2 15 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T49183 [Download] [View] Facility Assigned ID: TOVAL92TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read -- flanking 3' vector arm detected.
Passed all screens and filters
Sequence Entropy: 0.920 Expected Error Rate: 0.0043 Quality Trim Threshold: 12.5