EST details — SGN-E230320

Search information 
Request: 230320Match: SGN-E230320
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C57606Clone name: cLEL-33-H9
cartOrder Clone
Library Name: cLELOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: developing flower buds and flowers
Development Stage: anthesis-stage flowers from full grown plants, 4-8 weeks old

Microarray: This clone is not found on any microarray
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
No additional reads found.
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E230320Length: 366 bp (883 bp untrimmed)
Status: Current VersionDirection: 3'
>SGN-E230320 [] (trimmed) AATCCAATCGAAACCTCTACTTTTTCCTTTACATTTCTGTTTCACCAAAAATTGAAATACACATACTTACATCATCATAGGACATTATCCAATAA
GGAAAAATAAATAAAATTACAAGTGATTTTTTGGTTACACTTACATCAACTATTGATATGCACTATATCTTTAAAACGAGAAAAAGGAAAAACTT
AAAGATTTTTCAATTATATAACAAAAAAATAAAAACAAAAATGCTTTTCTCGAAAAAATAAATTTAGAGTCAAGTTTGGGCTTGTTAATTCAAAG
CGGGGGCCCAATCTATCATGAAAAACACGTTCCCCTTTCCTATAGCCCATGAAAAGTCTTTGCGAATCATTACGGCTTGAC
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E230320] SGN-U572830 Tomato 200607 Build 2 31 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T15403 [Download] [View] Facility Assigned ID: cC-esflcLEL33H09a1
Submitter: Koni Sequencing Facility: Cereon
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.903 Expected Error Rate: 0.0179 Quality Trim Threshold: 14.5