EST details — SGN-E230726

Search information 
Request: 230726Match: SGN-E230726
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C57802Clone name: cLEL-35-A12
cartOrder Clone
Library Name: cLELOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: developing flower buds and flowers
Development Stage: anthesis-stage flowers from full grown plants, 4-8 weeks old

Microarray: This clone is not found on any microarray
See unigene SGN-U579080 for alternative clones/ESTs which are mapped
Additional sequencing 
Clone: SGN-C57802 [cLEL-35-A12] Trace: SGN-T15597 EST: SGN-E230514 Direction: 3' Facility: Cereon
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E230726Length: 372 bp (900 bp untrimmed)
Status: Current VersionDirection: 3'
>SGN-E230726 [] (trimmed) AGACTTTCTTAGGTTCACATAGCAGGTACTTCCAAAAGTTAAAACATAAATCAAAATTATCCCATTACATCATTTAACTGAAGGGAGATGCAAAG
CAAAAAGCTCTAAGGCCATATGTCTTGCACCAGCACCAAATGTAGAGGTCCTCGTAGAAACTCGTATTCAAGATTTTTAACGGTACTTGATGAAG
CCAATTTCCTTGGCATTGCTGCGGAAGCACTGTCTGCAACACATGAGTCCATACTTTCTAATAATTGCATGAGGATTACCACACACACGGCATGT
GCGAGAGCCAGGGCCGTAGTTCTTTGGGTGGAGCGTTCCAGATGTTAGAGTGACCCATCTTCACAGAAAAGCGAGGCTGCGCGATGT
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E230726] SGN-U579080 Tomato 200607 Build 2 130 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T15809 [Download] [View] Facility Assigned ID: cC-esflcLEL35A12a1
Submitter: Koni Sequencing Facility: Cereon
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.975 Expected Error Rate: 0.0207 Quality Trim Threshold: 14.5