EST details — SGN-E230994

Search information 
Request: 230994Match: SGN-E230994
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C23297Clone name: cLED-5-A18
cartOrder Clone
Library Name: cLEDOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: ovary
Development Stage: 5 days pre-anthesis to 5 days post-anthesis

Microarray: Alias clone SGN-C174612 is on microarray TOM1: SGN-S1-1-7.4.15.4
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C174612 [TUS-19-D2] Trace: SGN-T189610 EST: SGN-E377256 Direction: 3' Facility: INRA
Clone: SGN-C174612 [TUS-19-D2] Trace: SGN-T189611 EST: SGN-E377257 Direction: 5' Facility: INRA
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E230994Length: 354 bp (433 bp untrimmed)
Status: Current VersionDirection: 5' [See links to 3' reads above]
>SGN-E230994 [] (trimmed) GGAGATCTATGGCCACCTTCACTCGAACAAAACCTCATGTAAATGTGGGAACTATAGGACACGTTGATCATGGAAAGACTACTCTTACTGCTGCA
ATTACAAAGGTTCTAGCAGAAGAAGGAAAGGCCAAGGCAATTGCATTTGATGAAATTGACAAAGCCCCTGAAGAGAAGAAGAGAGGAATTACTAT
TGCTACAGCCCACGTGGAGTATGAGACAGCTAAAAGACATTATGCTCATGTTGACTGCCCAGGACACGCGGATTACGTTAAAAATATGATTACCG
GAGCTGCCCAAATGGATGGTGGTATTCTAGTTGTATCTGCTCCAGATGGACCTATGCCGCAAACAAAGG
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E230994] SGN-U569141 Tomato 200607 Build 2 47 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T49610 [Download] [View] Facility Assigned ID: TOVAR09TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.975 Expected Error Rate: 0.0001 Quality Trim Threshold: 14.5