EST details — SGN-E231017

Search information 
Request: 231017Match: SGN-E231017
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C23526Clone name: cLED-5-K14
cartOrder Clone
Library Name: cLEDOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: ovary
Development Stage: 5 days pre-anthesis to 5 days post-anthesis

Microarray: Alias clone SGN-C174757 is on microarray TOM1: SGN-S1-1-6.2.15.6
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C174757 [TUS-19-J3] Trace: SGN-T189439 EST: SGN-E376825 Direction: 3' Facility: INRA
Clone: SGN-C174757 [TUS-19-J3] Trace: SGN-T189440 EST: SGN-E376826 Direction: 5' Facility: INRA
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E231017Length: 361 bp (430 bp untrimmed)
Status: Current VersionDirection: 5' [See links to 3' reads above]
>SGN-E231017 [] (trimmed) CACGTCGCACCTCTCCGCCACAACTCTCATCGTCACTACCTCACAACTCTATAAACTTCAGCCACTCACCATATTCGGAATGGGATTGGAGTTCT
AGGATAATGTTTTTGACTTCTCATCTATTTGAAAAATGAACTCACGTCACCTCTTTGGATTTTCTCATCTGAATCTTCACAAATCTAAGAAGACT
CTGAGAAGCTTGTACGTCCTGCACAATGGCGTTTATATGTAGTTCTCATTGTTGTTGTCGTCTTAGAATTTTCTGTTGTTGAGGGACCTATAGGG
GATATAGCCATAACTTATCCACAGGAGTAAAGCTTGAGAAGGAAGATGGTGGTATTCCAAGGGTCAAACAATTTGT
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E231017] SGN-U571432 Tomato 200607 Build 2 7 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T49633 [Download] [View] Facility Assigned ID: TOVAR67TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.972 Expected Error Rate: 0.0001 Quality Trim Threshold: 14.5