EST details — SGN-E231139

Search information 
Request: 231139Match: SGN-E231139
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C23439Clone name: cLED-5-G19
cartOrder Clone
Library Name: cLEDOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: ovary
Development Stage: 5 days pre-anthesis to 5 days post-anthesis

Microarray: Alias clone SGN-C181225 is on microarray TOM1: SGN-S1-1-2.3.15.21
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C181225 [TUS-36-G15] Trace: SGN-T187561 EST: SGN-E375003 Direction: 3' Facility: INRA
Clone: SGN-C181225 [TUS-36-G15] Trace: SGN-T187562 EST: SGN-E375004 Direction: 5' Facility: INRA
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E231139Length: 535 bp (806 bp untrimmed)
Status: Current VersionDirection: 5' [See links to 3' reads above]
>SGN-E231139 [] (trimmed) CAGATGGCATTGGCGTCAAATTCTTCTAAATCTAACATTGAGGCCAAAATTTTTCATCATGCAGGTAGAGTTCTAACATGTATTGCTAGAGAGGT
ATTTCTTTCCTTAGGAAGGTATTTTGTGCCAGTCCAGCATGTAAGATGGCATTTATGCTTGGTGCTTTGATTGGGATAGTCTTTATTTTTTTTCA
GGATGGAAAGAGTCCTTCTCAGCTATTGTTGGAGGAGATGAAGTGAAAGCTGGAAAGCCGTCTCCGGAAATATTTCTTGAAGCAGCTAAAAGACT
CAACATGGATCCATCCAGCTTTCTTGTCATTGAAGATTCAATATTTGCAACTAGAAAAGTGGGGACTACCTGCATTTCAAGATAGGATAGAAGGT
ACTTTGCCTTTAGAACCTTGGTATATAGGTGGTCCTGTCATTAAGGGATTTGGGCGCGGCTCAAAGGTTCTCGGGATCCCCACAGCTAATTTATC
CCCACAAGGTTATTCAGCCATTCTTTCAGAACATCCAACGGGTGTATATTTTGGATGGGC
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E231139] SGN-U572848 Tomato 200607 Build 2 12 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T49755 [Download] [View] Facility Assigned ID: TOVAQ46TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.964 Expected Error Rate: 0.0078 Quality Trim Threshold: 14.5