EST details — SGN-E231385

Search information 
Request: 231385Match: SGN-E231385
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C15096Clone name: cLED-10-L3
cartOrder Clone
Library Name: cLEDOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: ovary
Development Stage: 5 days pre-anthesis to 5 days post-anthesis

Microarray: Alias clone SGN-C181212 is on microarray TOM1: SGN-S1-1-7.3.15.17
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C181212 [TUS-36-G2] Trace: SGN-T193555 EST: SGN-E392229 Direction: 5' Facility: INRA
Clone: SGN-C181212 [TUS-36-G2] Trace: SGN-T193800 EST: SGN-E392474 Direction: 3' Facility: INRA
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E231385Length: 478 bp (772 bp untrimmed)
Status: Current VersionDirection: 5' [See links to 3' reads above]
>SGN-E231385 [] (trimmed) TGCAGAAGCAATTGTTGGAGATATCACTCCTGCTGATGGGGTTCCAAAGGACGAAAAGAGTAGACGAGAGCGAGCAGCACTAGAAGACATGTGTA
AACTTTTAGGTGGAGGATCCCGAGCCAAGGAAATCAGTGATTTATGGATGGAATATGAAGAAAATTCTTCTTTAGAAGCCAAAGTTGTGAAGGAC
TTCGACAAGGTGGAGATGATACTTCAGGCATTGGAATATGAAAATGAGCAAGGGAAGGATTTGGAAGAATTTTTCCAGTCAACTGCAGGTAAGTT
CCAAACAGAGGTGGGCAAAGCTTGGGCTTCAGAGGTAGCATCAAGAAGAAAGAAATCCAACTAAATTGTTGTGGTAGTCAAAGCTGGATAACAAC
TTGCACCAGTTGTATTGCTGATGACCCATATTCTAAAGGTTACAGGATCACTTGAAATAGAAGGATTCCTATAATAGCCCCATGGATTCTCTCAA
CTT
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E231385] SGN-U567698 Tomato 200607 Build 2 11 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T51236 [Download] [View] Facility Assigned ID: TOVBM62TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.954 Expected Error Rate: 0.0243 Quality Trim Threshold: 14.5