EST details — SGN-E231563

Search information 
Request: 231563Match: SGN-E231563
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C22949Clone name: cLED-4-B16
cartOrder Clone
Library Name: cLEDOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: ovary
Development Stage: 5 days pre-anthesis to 5 days post-anthesis

Microarray: Alias clone SGN-C174360 is on microarray TOM1: SGN-S1-1-3.1.16.19
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C174360 [TUS-18-I14] Trace: SGN-T189264 EST: SGN-E376650 Direction: 3' Facility: INRA
Clone: SGN-C174360 [TUS-18-I14] Trace: SGN-T189265 EST: SGN-E376651 Direction: 5' Facility: INRA
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E231563Length: 550 bp (781 bp untrimmed)
Status: Current VersionDirection: 5' [See links to 3' reads above]
>SGN-E231563 [] (trimmed) CAATTATCTCGATATTCCTTCCATCTCAGTTTATATTTTAGTTAAATAATTTCTTGTACTACATATTTTTAATTACTAACAATATTGAATTGTTA
GCAAGTATTTAAAATTTTCAAATATATTTTTATTTTAAAGAATTAAGTATTTTAACCTTTGTACTACGTCATCGTATAAATTCAGACGCAAGAAA
TACTAGTAATACATAAGGTGTAGGAAGAGAAAGATTTCCTCTATCTCCTTCATTTTTTTACTAAAAAAAAAAGAAGTTGCTAGTGAGTTAGGCCT
ATATAGTGTGTTACTTTTTGGTTCTTCACAATATTTTTCTCTATTTCCTCTATTGTGTTTTATGTAAAAATGGCTGGTATGCTACCTGGTGTTGA
ATGTGCTAGAAGAAGGAGATTTCATCAAAGTAATGGATGTATAGATTCATCAAACACCTCTAGTTTTTCATCCACAAGAAGGTCTTCTTTTTGTC
TATACACTAGTAATCATGAACACCACCTCAATTCAAGTTCATCCAAGCAAAGGGGTGTAATAAGTCAAGCATATC
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E231563] SGN-U577663 Tomato 200607 Build 2 21 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T49332 [Download] [View] Facility Assigned ID: TOVAP08TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.912 Expected Error Rate: 0.0039 Quality Trim Threshold: 14.5