EST details — SGN-E231692

Search information 
Request: 231692Match: SGN-E231692
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C23249Clone name: cLED-4-O16
cartOrder Clone
Library Name: cLEDOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: ovary
Development Stage: 5 days pre-anthesis to 5 days post-anthesis

Microarray: Alias clone SGN-C174579 is on microarray TOM1: SGN-S1-1-8.2.15.12
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C174579 [TUS-19-B17] Trace: SGN-T189478 EST: SGN-E376864 Direction: 5' Facility: INRA
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E231692Length: 478 bp (1217 bp untrimmed)
Status: Current VersionDirection: 5'
>SGN-E231692 [] (trimmed) GCATGATAAGATGGGCATGAACGTTATTCCACTGAAAGATTTGACTCCTGATGAAACAAAAACGATGACACTGAGTCTCCTAAAGAACATGGATG
CGAATGATTCTCAAAATGATAAGGACCGTGGTCAGATCATGGTGGAATTAACCTACAAACCATTTAAGGAGGATGAGTTGCCAAAAGATTTTGAA
GATAATGATGCAGCACATAAGGTTCCAGAAGGAACACCACCAGGGGGAGGCGTCCTTATGATTATTGTCCACGAAGCTCAAGATGTTGAAGGAAA
GCACCATACTAATCCATATGTCAAGATTCTTTNCAAAGGAGAGGAGAGAAAAACTAAGCAAGTCAAGAAGAACAGGGATCCAAGATGGGAAGAGG
AGTTTACTTTTGTGTTGGAGGAGCCTCCTGTGAATGATAGGGTGCATAATGAAGTTGTCAGCACCTCTACAAGGATTGGCCTATTGCATCCTAAG
GAG
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E231692] SGN-U574255 Tomato 200607 Build 2 32 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T49461 [Download] [View] Facility Assigned ID: TOVAN92TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.953 Expected Error Rate: 0.0126 Quality Trim Threshold: 14.5