Notice: The contact form functionality has been restored. Apologies for any inconvenience.

EST details — SGN-E231693

Search information 
Request: 231693Match: SGN-E231693
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C23251Clone name: cLED-4-O18
cartOrder Clone
Library Name: cLEDOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: ovary
Development Stage: 5 days pre-anthesis to 5 days post-anthesis

Microarray: Alias clone SGN-C174581 is on microarray TOM1: SGN-S1-1-6.2.15.12
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C174581 [TUS-19-B19] Trace: SGN-T189479 EST: SGN-E376865 Direction: 5' Facility: INRA
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E231693Length: 473 bp (1231 bp untrimmed)
Status: Current VersionDirection: 5'
>SGN-E231693 [] (trimmed) CAGGGGATCTCGTCGGAGACGACTCTCTCCCCACCGCGCACTCATCGCCACCGCAGCTTTCACTGTCGTCGGACTATTGATCCTAACTTTGAGGT
CCGTCGATCCGTCCACTCAGCTTCCAATCACCACCTCTGAAAACGTGAATGCTAAGCCAGCAGATACAAATCTTCACTCGAACCACTCCGATGCT
CAACCACTAAAAACATGCGCAACCGTGGAGGAGATGGGCGAGGTGTTTCGCAGCGGGTTTTGGAAGGAAAGTTACAGAGTGAGGAAAATCATCGA
AAGTCACTTTGCTATTAATGGTGCTTCGAGAGTTCGATCTCTTCCGCCGGAGGAGTTCTGCAGACATGGTTTCGTGTTGGGAAAAGCATCAGAAG
CAGGTTTTGGTAATGAGATGTACAAAATCTTAACTGCCGGAGCACTGAGTGTGATGTTGAACCGGTCGTTGATAATTGGGCAATCCAGGCATA
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E231693] SGN-U582795 Tomato 200607 Build 2 3 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T49462 [Download] [View] Facility Assigned ID: TOVAN93TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.985 Expected Error Rate: 0.0126 Quality Trim Threshold: 14.5