Notice: The contact form functionality has been restored. Apologies for any inconvenience.

EST details — SGN-E231714

Search information 
Request: 231714Match: SGN-E231714
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C23135Clone name: cLED-4-J19
cartOrder Clone
Library Name: cLEDOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: ovary
Development Stage: 5 days pre-anthesis to 5 days post-anthesis

Microarray: Alias clone SGN-C181175 is on microarray TOM1: SGN-S1-1-4.1.15.21
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C181175 [TUS-36-E13] Trace: SGN-T187554 EST: SGN-E374996 Direction: 5' Facility: INRA
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E231714Length: 534 bp (1173 bp untrimmed)
Status: Current VersionDirection: 5'
>SGN-E231714 [] (trimmed) CAGGCTAGGTGTGGCAGCATTAGGAAGGCACTTGAAGTGTTTCAAGGCATGAAAGAGAAGGACGTGTCGTCTTGGAACATAATTATATTAGGATT
AGCTTTCCATGGTCATTCTGAAGAATGTATCTCTCTTTTTGAAGATATGAGGAGAATGAAGTATATCCCTAATGAAATTACTTTTGTTGGTGTAT
TAGTTGCTTGTAGTCACGCTGGTAAAGTTGATGATGGCCGAGAATATTTCAGCATGATGAGAACTGACTACAATATTGAGACAAACATAAGGCAC
TATGGTTGTATGGTGGATATGCTAGCGCGTGCAGGACTATTGAATGAAGCGTTTGAGTTCATAAACACGATGGACATTAAACCTAATGCTATTAT
ATGGAGAACACTGCTAGGAGCTTGTAAAGTTCATTCCAATGTCAAGCTGGGAAGGTATGCGAATAAGCAGTTGCTTAAATTGGGAAGGGAAGACA
GTGGGGACTATGTCTTGCTGTCTAATATCTATGCATCGAGGGATGAATGGGATGGTGTG
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E231714] SGN-U562739 Tomato 200607 Build 2 4 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T49483 [Download] [View] Facility Assigned ID: TOVAO58TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.958 Expected Error Rate: 0.0149 Quality Trim Threshold: 14.5