EST details — SGN-E231823

Search information 
Request: 231823Match: SGN-E231823
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C24310Clone name: cLED-7-M7
cartOrder Clone
Library Name: cLEDOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: ovary
Development Stage: 5 days pre-anthesis to 5 days post-anthesis

Microarray: Alias clone SGN-C185612 is on microarray TOM1: SGN-S1-1-7.2.9.5
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C185612 [TUS-47-N10] Trace: SGN-T192505 EST: SGN-E391179 Direction: 3' Facility: INRA
Clone: SGN-C185612 [TUS-47-N10] Trace: SGN-T192506 EST: SGN-E391180 Direction: 5' Facility: INRA
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E231823Length: 538 bp (761 bp untrimmed)
Status: Current VersionDirection: 5' [See links to 3' reads above]
>SGN-E231823 [] (trimmed) GAGACTCAAGAAATGTTGGACTTTGCGGCAAAGCATAACATAACACCAGATATTGAAGTGGTGCCAATGGAGTACGTTAACACCGCGTTGGAACG
TCTTTTGAAATCGGACGTGAAATATCGTGTTGTGCTAGACATTGGTAATACATTGAACAAGAAATGAGAATAGGGAGGGGATCAATTATGTAGCT
AGCAGTGTTTCCTCCATCATCTATTTATACTGCAGTAACTGAGATTTAGTGAATACCTTACAGAATAACAACCCTTTGCCTTTACTCTATTAACT
AAGTGAAATCCGTATATCTCTGATACATCTTTTCACATGAAAATCATACATCATGGTCAAATTCTGAACTTAGTACTCAAGAAGACAGCTTGCAC
TAATGAATTATGACGGAACACCAAGATATGATGCATGTTGCAAGATGACACTGTACTTTTTCCTCAAAAAAATGACACAGAGTACTCCACAGGCT
GTCACTTTGATTTTAAACGATACATCTATATGTTTTCTTTCCAACTTGTTTATCTCATAAAAT
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E231823] SGN-U572059 Tomato 200607 Build 2 13 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T50332 [Download] [View] Facility Assigned ID: TOVAY76TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.959 Expected Error Rate: 0.0149 Quality Trim Threshold: 14.5