EST details — SGN-E231850

Search information 
Request: 231850Match: SGN-E231850
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C24162Clone name: cLED-7-G14
cartOrder Clone
Library Name: cLEDOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: ovary
Development Stage: 5 days pre-anthesis to 5 days post-anthesis

Microarray: Alias clone SGN-C175241 is on microarray TOM1: SGN-S1-1-2.2.13.1
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C175241 [TUS-20-N7] Trace: SGN-T190084 EST: SGN-E377585 Direction: 3' Facility: INRA
Clone: SGN-C175241 [TUS-20-N7] Trace: SGN-T190085 EST: SGN-E377586 Direction: 5' Facility: INRA
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E231850Length: 528 bp (812 bp untrimmed)
Status: Current VersionDirection: 5' [See links to 3' reads above]
>SGN-E231850 [] (trimmed) GTCTGGTCGACGCCCTGGAGATGCTGAAATTGTATATGCTGCTACTGAGAAAGCAGAACGCGAATTGAAGTGGAAGGCGAAATATGGCATCGAAG
AGATGTGTAGGGATCAGTGGAACTGGGCTAAGAAGAATCCCTATGGCTATGAAGGAACTCCAGAATCTAATAACTGTCACTGAAGTCTACTTCAA
CTGCATAATATCGTCATATAGTCGATACGTTCCTGTTGCTGCATCGTGTTCGAAGGGACGATTCAACGTATAGTTGTAGGGCTATTAGATGGCAT
TATAATGTTTATATTGTCTAACTTATATAAGTTTCAGAATGTAATTGGAGTTTCAATGAGTTAGTAGTTAGATTATAAAAGGGAAAATCTAAGAA
AGTTGATGAATAATATTTAAGCATATAGTAGTATTTCATTTGTTCTTTCATTCCTTTTTTGTTTGTATAATAAAATAACTATCGGCATTTGAATC
TCGTTTTAGCACATCATCATTGATTTCAACTAGTTTGAGATTGAGACGTAATC
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E231850] SGN-U583215 Tomato 200607 Build 2 22 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T50359 [Download] [View] Facility Assigned ID: TOVAZ43TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read -- flanking 3' vector arm detected.
Passed all screens and filters
Sequence Entropy: 0.955 Expected Error Rate: 0.0093 Quality Trim Threshold: 12.5