EST details — SGN-E231955

Search information 
Request: 231955Match: SGN-E231955
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C24037Clone name: cLED-7-A19
cartOrder Clone
Library Name: cLEDOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: ovary
Development Stage: 5 days pre-anthesis to 5 days post-anthesis

Microarray: Alias clone SGN-C175170 is on microarray TOM1: SGN-S1-1-1.3.14.21
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C175170 [TUS-20-K8] Trace: SGN-T189926 EST: SGN-E377715 Direction: 3' Facility: INRA
Clone: SGN-C175170 [TUS-20-K8] Trace: SGN-T189927 EST: SGN-E377716 Direction: 5' Facility: INRA
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E231955Length: 316 bp (778 bp untrimmed)
Status: Current VersionDirection: 5' [See links to 3' reads above]
>SGN-E231955 [] (trimmed) TTGAGACCCAACAAGCTAAGAAAGTTAAGAGTGGTGTTAATGTTCATAAAGATTCGTTAAAGCTTGAGATTGATGAGCAAAACCCAGATCATTAT
TTGGTTTCTTTTGTCTTTGATGCTCTCTTTGATGGAAACATCACAGTGTTTTATTTTGTCAAGGAAGAGCCTCATTGCAGATTTGTTCCAATATA
CCCCCATGTCCATGTACCTATAACAGTTCCTTTCCAGAGAGGACTTGGACAGAAATTTCGTCAGCCTTTTGGGGCAGGCATTGACTTGAGTTTCT
TTGAAATGGACGATCTCTCCGAACTATCATC
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E231955] SGN-U582147 Tomato 200607 Build 2 21 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T50464 [Download] [View] Facility Assigned ID: TOVAY10TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.965 Expected Error Rate: 0.0181 Quality Trim Threshold: 14.5