EST details — SGN-E231961

Search information 
Request: 231961Match: SGN-E231961
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C24117Clone name: cLED-7-E15
cartOrder Clone
Library Name: cLEDOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: ovary
Development Stage: 5 days pre-anthesis to 5 days post-anthesis

Microarray: Alias clone SGN-C175214 is on microarray TOM1: SGN-S1-1-5.1.13.1
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C175214 [TUS-20-M4] Trace: SGN-T189861 EST: SGN-E377650 Direction: 5' Facility: INRA
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E231961Length: 300 bp (783 bp untrimmed)
Status: Current VersionDirection: 5'
>SGN-E231961 [] (trimmed) TTCAAACACAAACTCAACCCAACAAGATGCGTCTTCTTCTTTCAATAATTCAAACAACTCTCAATCTTCACTGTTGCAAGGATCCAATGGTATGT
TGCCAGGGACAGTGCAGAACTTACCTGTCAGTGGGTTGCCAAGTACCAGTCTGCAGCAACAACAGCAGCAATTACTGAGTAGTGGTTTACTCTCG
CAAAGTCAATCTCAATCCTCGCAGGGAAGCCAGGCGCTGCAGCAGCAAATGATCCAGCAGCTCCTCCAGGACATGAACACCAACAATGGTGGGTC
TGGAGTTCAACAGCA
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E231961] SGN-U575406 Tomato 200607 Build 2 24 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T50470 [Download] [View] Facility Assigned ID: TOVAY32TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.974 Expected Error Rate: 0.0236 Quality Trim Threshold: 14.5