Notice: The contact form functionality has been restored. Apologies for any inconvenience.

EST details — SGN-E231986

Search information 
Request: 231986Match: SGN-E231986
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C24342Clone name: cLED-7-O19
cartOrder Clone
Library Name: cLEDOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: ovary
Development Stage: 5 days pre-anthesis to 5 days post-anthesis

Microarray: Alias clone SGN-C175348 is on microarray TOM1: SGN-S1-1-7.2.13.18
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C175348 [TUS-21-B18] Trace: SGN-T1366 EST: SGN-E378674 Direction: 5' Facility: Giov. Lab
Clone: SGN-C175348 [TUS-21-B18] Trace: SGN-T190638 EST: SGN-E378024 Direction: 5' Facility: INRA
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E231986Length: 280 bp (783 bp untrimmed)
Status: Current VersionDirection: 5'
>SGN-E231986 [] (trimmed) GGAAACCCTCTCTCTCTCAATTGTCAAACAATCAAATTCTGAGTTGTAAAGCTTCAGACGTTATGGGAAAGGACTCCAAGTCTAAGGATTCTGGA
AGCAAGGGAAAGGGTAAACAGGCTGCTGGTGGAAGTGAGGATAATGCTTCTAAAGGAAAAGGAAAAGGTGGGAAAGGAGATGGCCTTGGAACCTG
CACATATGTTAAAGCAACGCATGTCTTATGTGACAAGCAGTCAAAGATTAATGAAGCATACAAAATACTACAGGATGGCTGGCTGAACAA
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E231986] SGN-U564374 Tomato 200607 Build 2 20 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T50495 [Download] [View] Facility Assigned ID: TOVAY94TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.954 Expected Error Rate: 0.0098 Quality Trim Threshold: 14.5