EST details — SGN-E232018

Search information 
Request: 232018Match: SGN-E232018
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C24222Clone name: cLED-7-I8
cartOrder Clone
Library Name: cLEDOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: ovary
Development Stage: 5 days pre-anthesis to 5 days post-anthesis

Microarray: Alias clone SGN-C175278 is on microarray TOM1: SGN-S1-1-5.3.13.9
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C175278 [TUS-20-O20] Trace: SGN-T189876 EST: SGN-E377665 Direction: 5' Facility: INRA
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E232018Length: 690 bp (781 bp untrimmed)
Status: Current VersionDirection: 5'
>SGN-E232018 [] (trimmed) CTGATCTTGATGATGTATATAGGGAAGTTATGAGGGATTTTGCTAAAAGATTAGAGAAGTTAGCAGAAGAACTCTTGGATTTGCTTTGTGAAAAC
CTTGGACTAGAAAAAAGTTACTTGAAAAATACATTTTATGGCTCAAAAGGTCCAAATTTTGGGACTAAAGTAAGTAACTATCCACCATGTCCAAA
ACCTGATCTAATAAAGGGGTTGCGTGCACATACTGATGCTGGTGGCATAATACTTCTCTTCCAAGATGACAAGGTGAGTGGCCTACAACTGCTCA
AAGACGGTCGATGGATCGATGTTCCTCCCATGCGCCACTCCATCGTGGTTAACCTAGGTGACCAACTCGAGGTAATCACGAACGGGAAGTACAAG
AGTGTGATGCATAGAGTGATCGCACAAAAAGACGGGACTCGGATGTCATTAGCATCCTTCTACAATCCAGGAAATGATGCATTGATCTATCCAGC
ACCAGCTCTAGTTGATAAAGAGGCAGAGGAACATAACAAACAAGTTTACCCTAAATTTATGTTTGATGATTACATGAAATTATATGCTAATCTCA
AATTTCAAGCCAAAGAGCCAAGATTTGAAGCCATGAAAGCTATGGAAAGTGATCCAATTGCAATTGCTTAGATTAAAAATTAATAAAATTGGAAG
AAAAATTATTTGTTATTGACATACA
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E232018] SGN-U580531 Tomato 200607 Build 2 20 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T50527 [Download] [View] Facility Assigned ID: TOVAZ52TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.975 Expected Error Rate: 0.0058 Quality Trim Threshold: 14.5