Notice: Due to a regional power outage, SGN was briefly unavailable on Saturday, Feb 4. We apologize for the inconvenience.

EST details — SGN-E232768

Search information 
Request: 232768Match: SGN-E232768
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C24531Clone name: cLED-8-K22
cartOrder Clone
Library Name: cLEDOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: ovary
Development Stage: 5 days pre-anthesis to 5 days post-anthesis

Microarray: This clone is not found on any microarray
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C168999 [TUS-4-J5] Trace: SGN-T190936 EST: SGN-E389610 Direction: 3' Facility: Avesthagen
Clone: SGN-C168999 [TUS-4-J5] Trace: SGN-T191193 EST: SGN-E389867 Direction: 5' Facility: Avesthagen
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E232768Length: 366 bp (1206 bp untrimmed)
Status: Current VersionDirection: 5' [See links to 3' reads above]
>SGN-E232768 [] (trimmed) GGGAGTTCTGTTGCTGGAGATTCTCACCGGGAAAGAAGTTTCCGCTTTATATGAAGGTTCAAACACAAACTTGGCTGAGTTGTTGATCCCGGTGC
TTAATGATGATAATGCAAAGGAGAGTTTGAGCAACTTCGTTGACCCTTCTCTGCAAGGGAAGTACCCTGTGGAACTTGCTTTTGCCATGGTCAGA
TTGATCGATAACTGCCTAATGAAAGATCCCTCACATCGCCCTAATACGGATGAGATTGTGCAATCTGTTTCAAGAATTATGACAGCCACACACTC
ATGGGAAACGTCATTTAGCACTTCAGTGTCACCACATAGATTGCCCTAGATCAATGATTGGTTTTCTTTGGTGGTTATTTT
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E232768] SGN-U564297 Tomato 200607 Build 2 60 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T50701 [Download] [View] Facility Assigned ID: TOVBD71TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read -- flanking 3' vector arm detected.
Passed all screens and filters
Sequence Entropy: 0.982 Expected Error Rate: 0.0089 Quality Trim Threshold: 12.5