EST details — SGN-E232807

Search information 
Request: 232807Match: SGN-E232807
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C24593Clone name: cLED-8-P10
cartOrder Clone
Library Name: cLEDOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: ovary
Development Stage: 5 days pre-anthesis to 5 days post-anthesis

Microarray: Alias clone SGN-C181138 is on microarray TOM1: SGN-S1-1-1.3.14.3
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C181138 [TUS-36-C24] Trace: SGN-T193546 EST: SGN-E392220 Direction: 5' Facility: INRA
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E232807Length: 527 bp (839 bp untrimmed)
Status: Current VersionDirection: 5'
>SGN-E232807 [] (trimmed) GGAGATTTGGTAATACATGCAGCTTATCTTTCGGGGACATGGCAAACATATGTGGTAGAAGATCAAAGTTTATGGTACAAAATAGACAAAAACAC
TCCAATTGAATATGCTGCCACTATTTCTGTTAATCCATTGAGTGCCTTGAGAATGCTTGAGGATTTTGTGGCTTTAAAATCAGGGGACACAATTG
TTCAAAATGGAGCTACAAGCATAGTAGGGCAATGTGTTATTCAATTAGCTCGAATTCGTGGAATTCATAGCATTAATATCATAAGAGATAAACCT
GATTCTGATAAAATTAAGGAAAAATTAATCAAACTTGGAGCTACTAAAGTATTTACTGAAAGTGAACTCGAAGTCAAAGATGTCAAAAAACTCCT
GGGTGATATACCTAAACCTAGTTTGGGTTTGAATTGTATTGGTGGAAATGCAGCTAATATGGTGGTAAAATTCTTAAAGCAAGGTGGCACTATGG
TTACATATGGAGGGATGTCAAAGAAGCCAATTACTGTATCTACTACACATTT
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E232807] SGN-U562655 Tomato 200607 Build 2 8 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T50740 [Download] [View] Facility Assigned ID: TOVBF89TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.950 Expected Error Rate: 0.0087 Quality Trim Threshold: 14.5