EST details — SGN-E232846

Search information 
Request: 232846Match: SGN-E232846
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C24532Clone name: cLED-8-K23
cartOrder Clone
Library Name: cLEDOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: ovary
Development Stage: 5 days pre-anthesis to 5 days post-anthesis

Microarray: This clone is not found on any microarray
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
No additional reads found.
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E232846Length: 379 bp (999 bp untrimmed)
Status: Current VersionDirection: 5'
>SGN-E232846 [] (trimmed) CAGGCATCAGCTAAAGGAAAACGTGTTCAGTCCAATATGGGAGCCAAAAACCACGGGGTCGTCATGCCAGATGCAAACATAGATTCTACAGTAAA
TGCTTTAGTGGGGGCTGGTTTTGGTGCAGCAGGGCAAAGATGCATGGCATTGAGCACAGTGGTTTTTGTTGGTGACTCAAAACCTTGGGAAGAAA
AACTGTTGGAACGTGCAAAAACTCTGAAGGTCAATGCTGGAACAGAACCTGATGCAGATCTTGGTCCAGTAATTAGCAAGCAGGCAAAAGAACGA
GTATGTCGATTGGTTCAAAGTGGCGTTGATAGTGGAGCCAAATTATTGCTTGACGGAAGAGATATTGTGGTCCCAGGATATGAAAAAGGCAATT
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E232846] SGN-U567272 Tomato 200607 Build 2 30 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T50779 [Download] [View] Facility Assigned ID: TOVBC72TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.957 Expected Error Rate: 0.0063 Quality Trim Threshold: 14.5