EST details — SGN-E233092

Search information 
Request: 233092Match: SGN-E233092
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C24012Clone name: cLED-6-P17
cartOrder Clone
Library Name: cLEDOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: ovary
Development Stage: 5 days pre-anthesis to 5 days post-anthesis

Microarray: Alias clone SGN-C181413 is on microarray TOM1: SGN-S1-1-6.3.14.2
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C181413 [TUS-36-O11] Trace: SGN-T187601 EST: SGN-E375043 Direction: 3' Facility: INRA
Clone: SGN-C181413 [TUS-36-O11] Trace: SGN-T187602 EST: SGN-E375044 Direction: 5' Facility: INRA
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E233092Length: 653 bp (781 bp untrimmed)
Status: Current VersionDirection: 5' [See links to 3' reads above]
>SGN-E233092 [] (trimmed) CCCTTGTACAAGCCCAGAAATGTCAATATGATACCTCCCAAAAACCCATATTGTGTTGAGGTACAAGAGAATCTGAGATCCAAGTATTGTGATAA
CTGCCATCAATGTGATTATGAGATAGAATACGCTGACCGCAGCTCTTCTGTTGGGGTTCTTGCAAAGGATGAACTTCAATTGGTGCTTGCAAATG
GGACTGGAACCAAGCCAAATGTTGTTTTCGGCTGTGCATATGATCAGCAAGGCACACTTCTCAACACTTTAGCAAGCACTGATGGGATCCTAGGA
CTCAGCAGAGCTCCAATCAGTTTGCCTTCTCAGCTAGCGAGTCATGGGTTAATCAACAATGTTATTGGACATTGTCTTCGCACTGATACAAATGG
GGGCTACTTGTTCCTAGGCAATGACTTTGTCCCACAGTGGCGGATGTCATGGGTCCCTATGCTGAATAACCCTTTTCCTAATCTTTATCAAGCAC
AATTGATGAAAATGAACTATGGAGGCAAAGACCTTCAATTAGGCAGCAGAGGCTATGGACAAGATTCTGTAGTGTTTGACAGTGGCAGTACTTAT
ACATATTTTACAGATCAAGCATACAAAGCTTTGATTTCCATGCTTGAAGAGATTTCCAGTGAAGATCTTATCAAGGATGCATC
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E233092] SGN-U584523 Tomato 200607 Build 2 31 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T50078 [Download] [View] Facility Assigned ID: TOVAW93TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.969 Expected Error Rate: 0.0037 Quality Trim Threshold: 14.5