EST details — SGN-E233182

Search information 
Request: 233182Match: SGN-E233182
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C23835Clone name: cLED-6-H23
cartOrder Clone
Library Name: cLEDOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: ovary
Development Stage: 5 days pre-anthesis to 5 days post-anthesis

Microarray: Alias clone SGN-C174997 is on microarray TOM1: SGN-S1-1-6.4.14.19
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C174997 [TUS-20-D3] Trace: SGN-T189959 EST: SGN-E377460 Direction: 3' Facility: INRA
Clone: SGN-C174997 [TUS-20-D3] Trace: SGN-T189960 EST: SGN-E377461 Direction: 5' Facility: INRA
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E233182Length: 559 bp (782 bp untrimmed)
Status: Current VersionDirection: 5' [See links to 3' reads above]
>SGN-E233182 [] (trimmed) TCGGCACCAGGCTTAACCAACGAGAGAGATGAGAGGAGTGGGAGGGCCGTTGTTATGCATCGGCGATCTGCTGAGTGACGTTGGAGAAAGCGATG
CCGGCGGTGATCAACTTCCGTCGCACCCAATCAATACACCTCCACCGGATTTCAACTCCAGCCTCCAACCCTCCGATCTAAACAAGCTCTTTCAG
GAAAAGTATGAGCAGCTGAACAAGGCACTTGCTGGCACAGATCATTCATGGACGCATCTCACACTGGAGCTATGCACTGCACTGGAGACTGCAAA
CAAGTTGGTTCACTCGACCAATTCTAATGTTGGCATGTTGAAAGATAAGGTTGAGGAGCTTTGGGAAGTCATTAATAGAAGAGACGCAACTATTG
AAGCGGCAAAAGCCTTTGAAGGCTCTCCAAAACAACCTGAGAGCAGTTAGTGAGGATGTCTGATCAATTACCAAGTTGAAGGTCAGCAGTCTTGC
TTTGCACTGGACTTATCACTTCTAGCTTTTACAAGGACATTTTTAGCCTGTTCTTGCTGTAAATATGCATGAATTAAAGATATT
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E233182] SGN-U569409 Tomato 200607 Build 2 16 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T50168 [Download] [View] Facility Assigned ID: TOVAW48TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.978 Expected Error Rate: 0.0025 Quality Trim Threshold: 14.5