EST details — SGN-E233195

Search information 
Request: 233195Match: SGN-E233195
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C24027Clone name: cLED-6-P9
cartOrder Clone
Library Name: cLEDOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: ovary
Development Stage: 5 days pre-anthesis to 5 days post-anthesis

Microarray: Alias clone SGN-C181411 is on microarray TOM1: SGN-S1-1-8.3.14.2
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
No additional reads found.
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E233195Length: 666 bp (1329 bp untrimmed)
Status: Current VersionDirection: 5'
>SGN-E233195 [] (trimmed) GCAAATTTCAGGTTGTCTATATTGGAGATGGAAATAACATAGTGCATTCTTGGTTGCTACTTGCTTCAGTAATTCCTTTCCACTTTGTATGTGCT
TGTCCAAAAGGTTTTGAACCTGATGAAGAAACAGTTAAGAAAGCACAAGATGCTGGAATCAGCAAAATCGAGATAACTAATGATCCAAAGGAAGC
AATTAGAGGAGCTGATGTTGTATATTCTGATGTCTGGGCGAGTATGGGACAAAAAGAAGAAGCTGCACAGCGTCGTCAGGTGTTTCAAGGATTCC
AGGTTGGAGTGTGATAAATTTCTAAGCTCTATCTAGTCTATTCGACTTGTGCATGTAGTACAAGACACCTATTCATATATACATAAAATTGCTTG
CCAGGAAAGCAGGCAAACCCAGTAGTATAGGAGGCTAGTGCCCCTCGATGTTGATGCTTTTATGAATACCCATCTAAAAGTTTTGCTGTTCTTGA
ATTCCTTTCTAGCTAGTATTTCCCTAACATGTTATTATTTATCAATAGGTTGACGAAGAACTCATGAAAATAGCTGGACGGAAGGCTTATTTTAT
GCACTGTTTGCCTGCAGAAAGGGGAGTTGAAGTCACTAATGGCGTGGTTGAAGCACCAAACTCAATTGTATTTCCCCAAGCTGAAAACCGGATGC
A
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E233195] SGN-U575133 Tomato 200607 Build 2 7 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T50181 [Download] [View] Facility Assigned ID: TOVAW89TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read -- flanking 3' vector arm detected.
Passed all screens and filters
Sequence Entropy: 0.970 Expected Error Rate: 0.0153 Quality Trim Threshold: 12.5