EST details — SGN-E233301

Search information 
Request: 233301Match: SGN-E233301
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C23976Clone name: cLED-6-N22
cartOrder Clone
Library Name: cLEDOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: ovary
Development Stage: 5 days pre-anthesis to 5 days post-anthesis

Microarray: Alias clone SGN-C175121 is on microarray TOM1: SGN-S1-1-2.1.14.21
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C175121 [TUS-20-I7] Trace: SGN-T189773 EST: SGN-E377018 Direction: 5' Facility: INRA
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E233301Length: 568 bp (768 bp untrimmed)
Status: Current VersionDirection: 5'
>SGN-E233301 [] (trimmed) TAATTTGTGTGTTAAACAAGAATCCAAAGGGAAGTTTCTTACAAACTCCCCACATTTCAGTTAGCTAGCTACTATAAATTAACTCATAATTACAC
CATTTTCTTAATTAATTCCTCTAAATTAAAGAATAATGGGTGTTGGAGGAACATTAGAGTATATCTCAGAAATGATGAGTATTGAAAAGCCAAAG
AAGAAGAAGAAGCAGTTTAATACAGTGGAACTTAAAGTTAGAATGGATTGTGAGGGCTGTGAAATGAAAGTCAAAAATACATTATCTTCCATGAG
TGGAGTGAAATCAGTGGAGATAAACAGGAAACAACAGAAGGTGACAGTAACAGGCTATGTGGAACCAAACAAAGTGTTAAAGAAGGCAAAGTCAA
CTGGAAAGAAGGCAGAGATATGGCCTTATATCCCATACAATTTGGTATCCCAGCCATATGCTGCTCAAGCTTATGATAAAAAGGCGCCTTCTGGC
TACGTCAGGAGGGTCGATCAGTACCCAACCACGGGTACTGTTGCGAGATATGAGGATCCTTCCTATGTCAACATGTTTAGTGATGACAATCCT
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E233301] SGN-U573520 Tomato 200607 Build 2 11 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T50287 [Download] [View] Facility Assigned ID: TOVAX83TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.955 Expected Error Rate: 0.0070 Quality Trim Threshold: 14.5