Notice: After server upgrades, BLAST should be back now. Apologies for any inconvenience.

EST details — SGN-E233364

Search information 
Request: 233364Match: SGN-E233364
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C24648Clone name: cLED-9-C16
cartOrder Clone
Library Name: cLEDOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: ovary
Development Stage: 5 days pre-anthesis to 5 days post-anthesis

Microarray: This clone is not found on any microarray
See unigene SGN-U585837 for alternative clones/ESTs which are mapped
Additional sequencing 
No additional reads found.
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E233364Length: 243 bp (762 bp untrimmed)
Status: Current VersionDirection: 5'
>SGN-E233364 [] (trimmed) CAGATTGTGTTGTATATCAAGCGAGGATTCAAAGTTGCTCGTTTACGAGTACATGGTAAATCACAGTCTTGATAGATGGCTTCATGGGAAGAAGA
GAGTTTCCTTGAGTAATAAAGTCATGGATTGGCCAAAAAGATTGGAGGTTGCCATTGGAGCTGCTCAAGGACTTTGTTATATGCACCATGACTGC
ACTCCACCGATCATTCATCGCGATGTAAAATCAAGCAATATCTTGTTGGATTC
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E233364] SGN-U585837 Tomato 200607 Build 2 21 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T50925 [Download] [View] Facility Assigned ID: TOVBH20TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.966 Expected Error Rate: 0.0189 Quality Trim Threshold: 14.5