| SGN ID: SGN-C60459 | Clone name: cLEL-8-C22 |  | Order Clone |
|
| Library Name: cLEL | Organism: Solanum lycopersicum (formerly Lycopersicon esculentum) |
Tissue: developing flower buds and flowers
Development Stage: anthesis-stage flowers from full grown plants, 4-8 weeks old
Microarray: This clone is not found on any microarray
There is no map position defined on SGN for this EST or others in the same unigene.
| Sequence Id: SGN-E234100 | Length: 440 bp (887 bp untrimmed) |
| Status: Current Version | Direction: 3' |
>SGN-E234100 [] (trimmed)
AGCACAAAACAGTTGAAATTTGTAAACATCCACTAACACATCTTACACGACTTAAATGAACCATAGGCTCACGCGTAATTATTGAAAACATAAAA
AAGTACAAACAGACGAACAAAAATTAGAAAAACTATTAAGAGCTATCGACTTTAGATTCTCCTTCACAAACAAAAGTTCCATCGACAGTGTAATA
GTTGCAACCCTTACTGCCTGCACAACAATTGGTGCATATTCTACCTTCACTCCTTTTATTGCCTGGACATATCGAGTACGCTATTCTTGGATTAC
AATTACGAGGACAAGCTTTATTTGTTTCGTCTATAGTCTTTTTTGTCTGTCCTTCACAAATGAATGTTCCGTTAGCACTATAATAGTTGCAACCT
TCAGTGCCTGAGCAACAATTTGTGCATCCAACTTTGAACTTTTTGTTTCCAGATTTTGGG
[BLAST] [AA Translate]
| SGN-ID: SGN-T19086 [Download] [View] |
Facility Assigned ID: cC-esflcLEL8C22a1
|
| Submitter: Koni |
Sequencing Facility: Cereon |
Funding Organization: National Science Foundation
| Processed By: SGN |
Basecalling Software: phred |
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
| Sequence Entropy: 0.938 |
Expected Error Rate: 0.0130 |
Quality Trim Threshold: 14.5 |
