Notice: The SGN server will be upgraded later today. SGN may be intermittently unavailable during the upgrade. We apologize for any inconvenience.

EST details — SGN-E234582

Search information 
Request: 234582Match: SGN-E234582
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C59995Clone name: cLEL-6-P18
cartOrder Clone
Library Name: cLELOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: developing flower buds and flowers
Development Stage: anthesis-stage flowers from full grown plants, 4-8 weeks old

Microarray: This clone is not found on any microarray
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C59995 [cLEL-6-P18] Trace: SGN-T22326 EST: SGN-E280733 Direction: 3' Facility: Novartis
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E234582Length: 915 bp (untrimmed)
Status: Current VersionDirection: 3'
>SGN-E234582 [] (untrimmed)
GATGATGCTGGAACGCACCCCACCCGTTGGAAAATCGACGGGCCCGCGGCCGCTCTAGAAGTACTCTCGAGTTTTTTTTTTTTTTTTTTATAGAA
AAAGCTGAAAGAATTACATCCAACATGCTCAATCCTCGAGTAGAAGAGTTACATATCTTAGGCTTTCAATAGTTCAGGCTGCTAACCTACAATTT
TTTAATAATTAGAAATCATTTCTCCTCGTGCCGAATTCTTTGGATCCACTAGTGTCGACCTGCAGGCGCGCGAGCTCCAGCTTTTGTTCCCTTTA
GTGAGGGTTAATTTCGAGCTTGGCGTAATCAAGGTCATAGCTGTTTCCTGTGTGAAATTGTTATCCGCTCACAATTCCACACAATATACGAGCCG
GAAGTATAAAGTGTAAAGCCTGGGGTGCCTAATGAGTGAGCTAACTCACAGTCATTGCGGCTATGCGGATCTGACGGTTCACTAAACCAGCTCTG
CTTATATAGACCTTCCACCGTACACGCCTACCGNCCATTTGCGTCATGGGCGTGTAGTTTGTACGACATTTTGGAATGTCCGGTGATTTTGGTGC
CAAAACATACTCCATTTGACGTAATGGGGTGGAGACTTGAAAATCCCGGGAGTAAACCGTTTCCACGCCATTGATGACTTGCAAACCGATTACAT
GTTAATGCGATGACTATACGAGATGACTGCCAGTAGGAAGTCCATTAGCATGTCTGGCATATGCAGGCGCCATTACGCATGGCTAATTGGGCGCT
TGATTGATCCTGTGACGGCAGGGCGTTTCGAATTCTCCCTGCCTAGGAGGCCATGGTCCTTGGCCCCCTTTTCCTATGGGGGGGTGGCCCGGGCA
TCCCATTTAGGCTTTATGTTTTTCCCTTTTTTTCTCTTCCTATTTACTCTTCATTTGGTC
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
No current unigene builds incorporate this sequence
Chromatogram 
SGN-ID: SGN-T17360 [Download] [View] Facility Assigned ID: cC-esflcLEL6P18d1
Submitter: Koni Sequencing Facility: Cereon
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read -- flanking 3' vector arm detected.
Problems: Possibly chimeric (anomalous insert into vector)
Sequence Entropy: 0.898 Expected Error Rate: 0.0004 Quality Trim Threshold: 12.5