EST details — SGN-E235406

Search information 
Request: 235406Match: SGN-E235406
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C15278Clone name: cLED-11-H18
cartOrder Clone
Library Name: cLEDOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: ovary
Development Stage: 5 days pre-anthesis to 5 days post-anthesis

Microarray: Alias clone SGN-C184345 is on microarray TOM1: SGN-S1-1-2.1.16.7
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C184345 [TUS-44-I15] Trace: SGN-T192128 EST: SGN-E390802 Direction: 5' Facility: INRA
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E235406Length: 702 bp (831 bp untrimmed)
Status: Current VersionDirection: 5'
>SGN-E235406 [] (trimmed) CTATTTTCTTTTCCATCCTCTTTCCTTTTTCCCGGAAAATCGGAATTTAAATGGTGAGAGGAAAAGTAGAAATGAAAAGAATAGAAAATTCAACG
AGCAGGCAAGTGACGTTTTCGAAAAGACGAAATGGACTTACGAAGAAAGCTTATGAATTATCAGTTCTTTGTGATGCTGAAGTTGCTTTCATTAT
TTTCTCACATAAAGGAAGACTTTATGAATTTGCTAGCTCCAACATGCAGAAGATAATTGAGAGATACCGAGGACGTGCAAGAGAAACAACGACGG
TGGACAAAAGCACTGAACTCGAGCACTACATGGAGAACTTGAAGCATGAAACAGCTAATATGGCGAAGAAGATAGAGATCCTCGAAATTTCTAAA
CGGAAGCTAATGGGGCAAGGATTAGGGTCATGTTCAATGGATGAACTAGAAGACATTGACAGCCAACTGGAGAGGACCCTCAAAATTATCAGGGC
TAGAAAGACTCAATTGTTCAAAGAGGAAATAGAAAGTCTAAAAGCAAAGGAGAGACTATTGCTCCAACAAAATGCAAGTTTACGTGAAAAGTGCG
GGCTTAGGCCAATGCTATCAGAGTCAGCATCTGCACCCGAACCCATACCAGCACCACCATCAACACCACCAGCTCAATCAAAAGAAAGGGGAAAT
TGTAGCCAAAGTTCAAAGAGTTGGGAAGTGGAGACTG
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E235406] SGN-U577167 Tomato 200607 Build 2 9 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T51416 [Download] [View] Facility Assigned ID: TOVBR45TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.953 Expected Error Rate: 0.0025 Quality Trim Threshold: 14.5