EST details — SGN-E235435

Search information 
Request: 235435Match: SGN-E235435
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C15176Clone name: cLED-11-C23
cartOrder Clone
Library Name: cLEDOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: ovary
Development Stage: 5 days pre-anthesis to 5 days post-anthesis

Microarray: Alias clone SGN-C175391 is on microarray TOM1: SGN-S1-1-4.4.13.14
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C175391 [TUS-21-D13] Trace: SGN-T190513 EST: SGN-E377751 Direction: 3' Facility: INRA
Clone: SGN-C175391 [TUS-21-D13] Trace: SGN-T190514 EST: SGN-E377752 Direction: 5' Facility: INRA
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E235435Length: 585 bp (795 bp untrimmed)
Status: Current VersionDirection: 5' [See links to 3' reads above]
>SGN-E235435 [] (trimmed) TCCCCATTACATTGACTGAAAGCAAAAAAGGAGATTTATCTAGGGTTTCTGATTTGCAATTTCTCTCACAAATCTTCAGCAGAGATCAGATATGG
CGTCGCAAGAGTATTTGAACAAGATGCAGGTTCGACAGAATTATCGCAACCTTTGGCACACTGATCTTATGAGCACAATCCAAGCTGATACTCCT
TATTGCTGCTTTGCTTTGTGGTGTGGACCATGTGCATCATATTTGCTTCGGAAACGAGCTCTCTATGGTGATATGACAAGGTACACATGCTGTGC
GGGTTATATGCCCTGCAGTGGTCGTTGTGGAGAAAGTCGTTGTCCTGAGTTTTGCTTAGCAACTGAGGTTTTTCTCTGCTTTGGAAATTCAGTGG
CTTCCACCCGCTTCATGTTGCAAGATGAGTTCAACATACAAACAACGCGATGTGATAATTGCATTATTGGTTTTATGTTCTGCCTCCAACAAATT
GCTTGCATATTTTCAATTGTTGCTATGATTGTTGGAAGTGAGGAGATCCAGGAAGCTTCTCAGCTGCTGTCATGTTTGTCTGACATGGTCTACTG
CACGGGTTGTGCCTG
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E235435] SGN-U574162 Tomato 200607 Build 2 28 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T51445 [Download] [View] Facility Assigned ID: TOVBO24TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.972 Expected Error Rate: 0.0052 Quality Trim Threshold: 14.5