EST details — SGN-E235465

Search information 
Request: 235465Match: SGN-E235465
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C15394Clone name: cLED-11-M7
cartOrder Clone
Library Name: cLEDOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: ovary
Development Stage: 5 days pre-anthesis to 5 days post-anthesis

Microarray: Alias clone SGN-C175513 is on microarray TOM1: SGN-S1-1-2.1.13.16
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C175513 [TUS-21-I15] Trace: SGN-T190278 EST: SGN-E377087 Direction: 5' Facility: INRA
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E235465Length: 571 bp (908 bp untrimmed)
Status: Current VersionDirection: 5'
>SGN-E235465 [] (trimmed) TCCATTCTTTCTCCATTTCTTCAATGGCTTTTCCTTCCTCATTTCTCTTCTTCTTCCAAATCATTCTTTGTATTCCCTCTGCCTTCTCCACAAAT
TCTGAAGGGACTGCTTTGCATTCTTTGAGAACCAAACTTTCTGACCCAAAAAATGTTCTACAAAGCTGGGACCCTACACTTGTAAATCCTTGTAC
ATGGTTTCATGTTACCTGTGACTCAGATAATAATGTTATTCGCCTGGATTTGGGCAATTCTAATATTTCTGGAACATTAGGACCAGAACTTGGTG
AACTCAAGAATCTACAGTATCTGGAACTTTATAGTAATAACTTAGAAGGGGAAATCCCAAAGGAATTTGGTGATCTGGAAAATCTTATTAGCATG
GACCTATATGGCAACAAATTTGAAGGCAACATTCCCCAGTCTTTTGCTAAACTAAAGTCTCTTAGATTTTTACGGTTAAACGACAATGAACTAAC
TGGTTCGATTCCAAGGGAACTTACGACACTCCCCAACCTTAAAGTATTTGATGTTTCTAACAACAATCTTTGTGGAACAATCCCTGCTGATGGAC
C
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E235465] SGN-U582997 Tomato 200607 Build 2 16 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T51475 [Download] [View] Facility Assigned ID: TOVBO76TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.957 Expected Error Rate: 0.0012 Quality Trim Threshold: 14.5