EST details — SGN-E235758

Search information 
Request: 235758Match: SGN-E235758
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C16117Clone name: cLED-15-E17
cartOrder Clone
Library Name: cLEDOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: ovary
Development Stage: 5 days pre-anthesis to 5 days post-anthesis

Microarray: This clone is not found on any microarray
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
No additional reads found.
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E235758Length: 460 bp (1225 bp untrimmed)
Status: Current VersionDirection: 5'
>SGN-E235758 [] (trimmed) GTGGTAGTTCTTTTCAGGCGGGAATTATCTTTTGAGCAAACGCTCTGCCTATGGGAAGTAATGTGGGCAGACCAGGCTGCTATTAGGGCTGGGAT
TGGCAAGTCTGCCTGGAGTAGGATTAGGCTGCGTGCCCCACCAACAGATGATCTCTTGCTTTATGCAATTGCAGCATCTGTATTGCAACGGAGGA
AACAGATCATAGAGAAGTATAGTAGCATGGATGAAATTTTAAGGGAGTGCCAGAGCATGGCTGGTCAACTGGATGTATGGAAGCTTCTAGATGAT
GCCCATGACTTGGTGGTGACTCTCCATGACAAGATGTAGACATCTTTGTTATGGAGATCTTACACTAATTTATTCTCTTTGCTGCTCGAACTTTA
TTTTGTGGGATGATGCTACCAAACACTGCATGCATCTCCGGTACACAGGAAGAACTGAAGACAGCTTATGGTCAAGTAAT
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E235758] SGN-U567837 Tomato 200607 Build 2 21 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T52331 [Download] [View] Facility Assigned ID: TOVCE33THB
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.977 Expected Error Rate: 0.0112 Quality Trim Threshold: 14.5