EST details — SGN-E235934

Search information 
Request: 235934Match: SGN-E235934
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C16468Clone name: cLED-16-J22
cartOrder Clone
Library Name: cLEDOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: ovary
Development Stage: 5 days pre-anthesis to 5 days post-anthesis

Microarray: Alias clone SGN-C185890 is on microarray TOM1: SGN-S1-1-1.1.7.14
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C185890 [TUS-48-I24] Trace: SGN-T188352 EST: SGN-E376312 Direction: 5' Facility: INRA
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E235934Length: 265 bp (1060 bp untrimmed)
Status: Current VersionDirection: 5'
>SGN-E235934 [] (trimmed) CAGCCAAAACCAAAAAATAACAGAGAAAAAAAAAATGGTTCTCCTAACACCACCACGAACTCCGGCCAGAGCTGCGACGGCGATAGCCGGCTCAT
CGAAGCGGCTTATGGTGAATTTTATCGGTTCGATGTCTTTGTTAGCTTTGTGGTTGAAAAAAGCAAGCCGAGGAATTAAAACTCATAAACTCGGG
AGCGATTCGCCCAAATCGCCGCTAGCGAAGCCGAAGAAGTTCCTCGCGACGATTAGTAACAAAGCGGTTAATCTG
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E235934] SGN-U573139 Tomato 200607 Build 2 7 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T52507 [Download] [View] Facility Assigned ID: TOVCL59TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.967 Expected Error Rate: 0.0010 Quality Trim Threshold: 14.5