EST details — SGN-E236070

Search information 
Request: 236070Match: SGN-E236070
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C16348Clone name: cLED-16-D18
cartOrder Clone
Library Name: cLEDOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: ovary
Development Stage: 5 days pre-anthesis to 5 days post-anthesis

Microarray: This clone is not found on any microarray
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
No additional reads found.
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E236070Length: 267 bp (1045 bp untrimmed)
Status: Current VersionDirection: 5'
>SGN-E236070 [] (trimmed) CAGACTATTAAGTTTGGTAAGAAGAGTCATCCAGAATGTTCTAGGTTCTCACCGGATGGACAATTTCTTGTCTCATGCTCAGTTGATGGATTTAT
TGAGGTCTGGGATCACATAAGTGGAAAACTGAAGAAGGATCTTCAATATCAGGCTGATGAAACTTTTATGATGCATGATGATGCTGTCCTTTGTG
TTGATTTTAGCAGAGACTCGGAGATGCTCGCGTCTGGGTCACAAGATGGAAAAATAAAGGTCTGGCGCATAATGACT
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E236070] SGN-U563793 Tomato 200607 Build 2 20 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T52643 [Download] [View] Facility Assigned ID: TOVCL21TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.911 Expected Error Rate: 0.0051 Quality Trim Threshold: 14.5