EST details — SGN-E236319

Search information 
Request: 236319Match: SGN-E236319
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C17801Clone name: cLED-20-N11
cartOrder Clone
Library Name: cLEDOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: ovary
Development Stage: 5 days pre-anthesis to 5 days post-anthesis

Microarray: This clone is not found on any microarray
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
No additional reads found.
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E236319Length: 242 bp (1406 bp untrimmed)
Status: Current VersionDirection: 5'
>SGN-E236319 [] (trimmed) TCTTTTTTTATTAAGCTAATTTGTGTGTGAAACAAGAATCCAAAGGGAAGTTTCTTACAAACTCCCCACATTTCAGTTAGCTAGCTTACTATAAA
TTAACTCATAATTACACCATTTTCTTAATTAATTCCTCTAAATTAAAGAATAATGGGTGTTGGAGGAACATTAGAGTTTATCTCAAAAATGATGA
GTTTTGAAAAGCCAAAGAATAAGAAGAAGCAGTTTAATACAGTGGAACTTAA
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E236319] SGN-U573520 Tomato 200607 Build 2 11 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T53836 [Download] [View] Facility Assigned ID: TOVDA78TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.907 Expected Error Rate: 0.0256 Quality Trim Threshold: 14.5