Notice: If you try to use Google Chrome to access the SGN FTP site, please check this link to resolve connection issues.

Due to a hardware issue, SGN was briefly unavailable earlier today. We apologize for any inconvenience.

EST details — SGN-E236429

Search information 
Request: 236429Match: SGN-E236429
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C15583Clone name: cLED-13-F5
cartOrder Clone
Library Name: cLEDOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: ovary
Development Stage: 5 days pre-anthesis to 5 days post-anthesis

Microarray: Alias clone SGN-C181360 is on microarray TOM1: SGN-S1-1-3.1.15.19
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C181360 [TUS-36-M6] Trace: SGN-T193578 EST: SGN-E392252 Direction: 5' Facility: INRA
Clone: SGN-C181360 [TUS-36-M6] Trace: SGN-T199222 EST: SGN-E397896 Direction: 3' Facility: INRA
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E236429Length: 637 bp (978 bp untrimmed)
Status: Current VersionDirection: 5' [See links to 3' reads above]
>SGN-E236429 [] (trimmed) CCCAATCCCGGTATTTATATCAAATTAATTGTCATGCTTGGGAAATGTAAGGAACCTGAGAAAGCTCAATCTTTATTCGAGATGATGGTGGAGGA
AGGTTGTGTCGTGAATCAAGAAGCTTACACTGCTCTTTTGTCCGCCTATAGCCGTAGTGGTCGCTTTCACGAAGCTTTTTCTATCCTGGAAGAGA
TGAAGAACATTCCGAACTGCCTCCCGGATGTCTTCACATATTCCATCCTGATAAAATCCTGCCTGCAGGTTTATGACTTCGACAAAGTGCAAATT
CTGCTTTCCGACATGGAATGTTTGGGGATCAAGGCCAATACAGTAACATATAATACTCTCATTGATTCCTATGGGAAAGCGAAAAGGTTCAAAGA
GATGGAATCGACACTTGTTGAGATGCTACGGCGAAGAGACTGTAAGCCAGATGTCTGGACCATGAACTCAACACTGAGAGCATTTGGTGGCAGCG
GGCAAATTGAAATGATGGAAAAATGCTATGAGAAGTTTCAGAGTGCTGGAATTGAACCTAGTATCAAGACATTCAACATACTGTTAGATTCATAC
GGGAAAACAGAAAATTACGAGAAAATGGGTGCTGTGATGGAATTTATGCAGAAATATCATTTTTCAT
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E236429] SGN-U584678 Tomato 200607 Build 2 14 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T51707 [Download] [View] Facility Assigned ID: TOVBY27TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.975 Expected Error Rate: 0.0098 Quality Trim Threshold: 14.5