EST details — SGN-E236461

Search information 
Request: 236461Match: SGN-E236461
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C15785Clone name: cLED-13-P1
cartOrder Clone
Library Name: cLEDOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: ovary
Development Stage: 5 days pre-anthesis to 5 days post-anthesis

Microarray: Alias clone SGN-C184397 is on microarray TOM1: SGN-S1-1-6.3.16.11
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C184397 [TUS-44-K19] Trace: SGN-T191904 EST: SGN-E390578 Direction: 3' Facility: INRA
Clone: SGN-C184397 [TUS-44-K19] Trace: SGN-T191905 EST: SGN-E390579 Direction: 5' Facility: INRA
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E236461Length: 638 bp (985 bp untrimmed)
Status: Current VersionDirection: 5' [See links to 3' reads above]
>SGN-E236461 [] (trimmed) CAACAGTGGGATTTATGAGGCAAATATTGCTAAAAGCCCTGAAGGAAAAATGGCAGCCTGTACATACTTTAGCTGCCTCAGGAGAGTTTTACCTT
CTCACCTCTTTGTTGAAGCATGTTGTTGATATTAATGTTCCAGATAAGGATGGATTGACAGCTATCCATAAAGCAATTCTTGGCAAGAAGCAGGC
TATTTTTAACTTTCTTTTAAGAGAATCTGCAAATCCATTTATACTTGACAAAGATGGAGCCACCTTGATGCACTATGCTGTTCGAACGGCATCCA
CTCACATGATAAAAATCCTTCTCTTGTATAATGTTGATATAAACCTCCAAGATCATGATGGATGGACACCTTTGCATCTAGCTGTTCAATCCCGT
AGAACCGATATAGTGAGGCTTTTGTTAATTAAGGGAGCTGACAAGACTCTAAAGAACAGGGATGGTCTAACCCCACTTGACATATGCCTCCATTC
TGGTCGAGATATAAGGACGTATGAGCTTATCAAATTGTTGAAACAACTTCCCAAGGTTTCATTAGTTGGCTTGACCTAAAAATGCAGCTGCTAAC
CACGAAATTGGCGGATTGGTAGTTCCAGCTTTGAGTTTGGACTCTGTGTGAGTTATTTCTACAACACA
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E236461] SGN-U567201 Tomato 200607 Build 2 8 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T51739 [Download] [View] Facility Assigned ID: TOVBY85TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read -- flanking 3' vector arm detected.
Passed all screens and filters
Sequence Entropy: 0.976 Expected Error Rate: 0.0116 Quality Trim Threshold: 12.5