EST details — SGN-E236467

Search information 
Request: 236467Match: SGN-E236467
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C15486Clone name: cLED-13-B12
cartOrder Clone
Library Name: cLEDOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: ovary
Development Stage: 5 days pre-anthesis to 5 days post-anthesis

Microarray: Alias clone SGN-C175557 is on microarray TOM1: SGN-S1-1-6.3.13.16
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C175557 [TUS-21-K11] Trace: SGN-T190348 EST: SGN-E377157 Direction: 3' Facility: INRA
Clone: SGN-C175557 [TUS-21-K11] Trace: SGN-T190349 EST: SGN-E377158 Direction: 5' Facility: INRA
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E236467Length: 433 bp (877 bp untrimmed)
Status: Current VersionDirection: 5' [See links to 3' reads above]
>SGN-E236467 [] (trimmed) CAGGGTTCCATCAACCTGGGCGAAACTCAAAGGTGAAATTTGCTATTACTCATCATGGAAAGTTTAATGAAAGAGTATGCTGCTTTTGAAGAAAA
AGTAAAGCGTACTATCCTCATTGACAGCCTTTCACCTGCGGCTACTGAAGCTGTCGTTAGAGCTTCACTTGATCAATTTGGGAATGTCATTCAGG
TCAAGTTTATCCCAAACTACCTTGAACCAAAGACCGTTGGACTATCTGCATTGGTTGAGCTGGAAAATGCAGACCAGGCGAAAACTATAATCTCC
GAGATAAGCAGTTCCTCATTTATGATCTGTGGCATGCCAAGGCCTGTCAGGGCACGTGCTGCTGAAGTAGAGATGTTCGATGACCGTCCTATAAA
ACCTGGTAGGAAGATAGTATGCCGATGGTTGGACTCCAGTGATCCTGATTTTG
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E236467] SGN-U574858 Tomato 200607 Build 2 10 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T51745 [Download] [View] Facility Assigned ID: TOVBZ06TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.974 Expected Error Rate: 0.0131 Quality Trim Threshold: 14.5