EST details — SGN-E236520

Search information 
Request: 236520Match: SGN-E236520
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C15632Clone name: cLED-13-I1
cartOrder Clone
Library Name: cLEDOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: ovary
Development Stage: 5 days pre-anthesis to 5 days post-anthesis

Microarray: Alias clone SGN-C175630 is on microarray TOM1: SGN-S1-1-5.2.13.17
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C175630 [TUS-21-N12] Trace: SGN-T190750 EST: SGN-E378136 Direction: 5' Facility: INRA
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E236520Length: 453 bp (796 bp untrimmed)
Status: Current VersionDirection: 5'
>SGN-E236520 [] (trimmed) CAGGTTTGGTGATCATATGGGAGGTGAAATTGGATGGTTTTTTCTGTGTGAAGCACCGGTTTTCTGGACACCAGAAACCTGTCTCCAATATTTCA
TGGAGTCCTGATGACCATCAACTCCTTACTTGTGGGGTAGAGGAAGTTGTCAGACGATGGGATGTTGAATCACGTGAATGTATACATATTTATGA
GAAAAATGGTCTTGGTTTGATCTCGTGTGGATGGGCTCCTGATGGGAACAGGATATTATGCGGTGTTACAGACAAAAGCATTAGCATGTGGGATC
TGGAAGGGAAAGAGTTGGAGTGTTGGAAAGGCCATCGGACTATTAGAATATCAGACTTGGGGATAACTAGTGACTGGAAGCATGTAGTCTCTGTT
TGTAAAGATAATATGATACTATTATTTGGATGGGAATCAGAAGCAGAGAAAGTTATTCAAGAAGATCAAACAG
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E236520] SGN-U570622 Tomato 200607 Build 2 26 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T51798 [Download] [View] Facility Assigned ID: TOVBW49TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.954 Expected Error Rate: 0.0114 Quality Trim Threshold: 14.5