EST details — SGN-E236621

Search information 
Request: 236621Match: SGN-E236621
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C15498Clone name: cLED-13-B24
cartOrder Clone
Library Name: cLEDOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: ovary
Development Stage: 5 days pre-anthesis to 5 days post-anthesis

Microarray: Alias clone SGN-C175567 is on microarray TOM1: SGN-S1-1-4.3.13.20
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C175567 [TUS-21-K21] Trace: SGN-T190352 EST: SGN-E377161 Direction: 5' Facility: INRA
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E236621Length: 450 bp (860 bp untrimmed)
Status: Current VersionDirection: 5'
>SGN-E236621 [] (trimmed) CTTCTTTTCAATTTTTATTTTTAAAAAAATGTCTCCATCATTGGCAAAATCTAGTGAAAAATTGAAGAATGAAATTGAAGATTATCATAAAGGAG
TAAAGTATTTGCATGAAAGTGGAATTCAAAAAGTTCCAAAGAAATACATTTTTCCTATTTCAGAAAGACCAAATTGTTATACTATAAATGAAAAT
CCACAAGTTGCTAGCAAACACAATCTTAAGTTGCCTGTCATAGATTTTTCTCAACTCTATGGTCCTAATAGAGCTCAAGTTCTTGATTCACTCTC
CTATGCCTGTGAAAACTATGGATTTTTTCAGTTGACAAACCATGGGATTCCAGAAGAGGTAATAAAAAATATGGTGGATGTTGGAGGAAGGTTTT
TTGATCTTCCATTAGTAGAAAGGGAAAAGTACATGACAAAAGACATGACAACACCAGTTAGATATGGGAC
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E236621] SGN-U576069 Tomato 200607 Build 2 17 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T51899 [Download] [View] Facility Assigned ID: TOVBZ12TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.921 Expected Error Rate: 0.0064 Quality Trim Threshold: 14.5