EST details — SGN-E236894

Search information 
Request: 236894Match: SGN-E236894
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C60072Clone name: cLEL-7-C22
cartOrder Clone
Library Name: cLELOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: developing flower buds and flowers
Development Stage: anthesis-stage flowers from full grown plants, 4-8 weeks old

Microarray: This clone is not found on any microarray
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
No additional reads found.
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E236894Length: 354 bp (819 bp untrimmed)
Status: Current VersionDirection: 3'
>SGN-E236894 [] (trimmed) AGTTGCAATAGGAGATGACAGTCTACTGCATCTATTGCAAACAAAAGTAATTAACATGCACCCAAACTAAGGGGTGGGATTATTATAAAAAAACA
GACGACCTCGACCACAAACTAAAACAAACTGGAGATGCTAACAAGAGACACTTCAAGCAGAGTTTAGTAGGACCAAATCTCATCTTCCTCTGCTG
CAGCATTGTCTTCACTGTAATAGTAATAGCCACCATTATTGGTATTGGTATTGGCATTGGCAGTGGCTTCTGCAGTGAAGCAGCAAGACGAAAGG
TAAGGCATGTTGTGGAAGGACTGAGCTAAGCTGCTGGTCAAAGATCCAAAGGCAACACCTTCGCCTTCT
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E236894] SGN-U578034 Tomato 200607 Build 2 225 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T18258 [Download] [View] Facility Assigned ID: cC-esflcLEL7C22d1
Submitter: Koni Sequencing Facility: Cereon
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.965 Expected Error Rate: 0.0024 Quality Trim Threshold: 14.5