Notice: The SGN server will be upgraded later today. SGN may be intermittently unavailable during the upgrade. We apologize for any inconvenience.

EST details — SGN-E237246

Search information 
Request: 237246Match: SGN-E237246
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C60033Clone name: cLEL-7-A9
cartOrder Clone
Library Name: cLELOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: developing flower buds and flowers
Development Stage: anthesis-stage flowers from full grown plants, 4-8 weeks old

Microarray: This clone is not found on any microarray
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C60033 [cLEL-7-A9] Trace: SGN-T18420 EST: SGN-E237056 Direction: 3' Facility: Cereon
Clone: SGN-C60033 [cLEL-7-A9] Trace: SGN-T22334 EST: SGN-E279977 Direction: 3' Facility: Novartis
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E237246Length: 333 bp (881 bp untrimmed)
Status: Current VersionDirection: 3'
>SGN-E237246 [] (trimmed) AATAAAGCCACACTAATTTATTCCATTACGTATAGTAAGAGTACATGGAGACATTATAATGAACAAACATGAACCCTACTTATTATTTTTTGACA
TGTGGCTGCTTAATTACTTCAATAATAATTCATTAATTAACCAACCACTGGAATTGATACAGCAACATTTAAAATGTTTACAACAATACGAACTC
GAAAACACCTAAAATCAGCTGTGACTGGAGAACCATTCAATACTATTTGAACATCAGTTACGAATGGATTTTCCTTCTGAATTAATTCCCTTAGC
ATATTGTGCTGGTACACCAATAAGTTCTGGCCAACTTAATTTTTCTTT
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E237246] SGN-U578980 Tomato 200607 Build 2 13 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T18610 [Download] [View] Facility Assigned ID: cC-esflcLEL7A09d1
Submitter: Koni Sequencing Facility: Cereon
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.919 Expected Error Rate: 0.0088 Quality Trim Threshold: 14.5