EST details — SGN-E237546

Search information 
Request: 237546Match: SGN-E237546
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C17443Clone name: cLED-19-L1
cartOrder Clone
Library Name: cLEDOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: ovary
Development Stage: 5 days pre-anthesis to 5 days post-anthesis

Microarray: Alias clone SGN-C175940 is on microarray TOM1: SGN-S1-1-7.3.11.10
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
No additional reads found.
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E237546Length: 454 bp (821 bp untrimmed)
Status: Current VersionDirection: 5'
>SGN-E237546 [] (trimmed) CAAACATTTGCCCTTAAAATATGCACATAGTCTAGATATTTAAGCACCAGATCGTAGTTTTTTCCAGTTGAAAGAGAAAAAAAGGTGATTTCAAT
TTGCAGTTGTTAATCCTAAGGATGAGGATTGAGAAAAATGTGAGTGAACCAAGAGGACGGGAGTATAGCGATTCGAAGAAGAATCGGAGAAGGCA
GAGGATGATTTCCCCGGTTCAAAGACTTTATGAAACTTGCAAAGAAACTTTTGCTAATTGTGGTCCTGGTGTTGTACCATCTGCAGAAAAGATTG
AACGTCTCAAGGAAGTTTTGGATACCATGGCTGGAGCAGACGTTGGCTTGAGACCGAACATGCCATACTTTAAGTCAACAAGATATGACAGACCT
CCTACAATAACGTACCTGCACCTCCATGAGTGTGATAAATTCTCGATTGGTATCTTCTGCTTGCCCCCATCAGC
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E237546] SGN-U571482 Tomato 200607 Build 2 24 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T53460 [Download] [View] Facility Assigned ID: TOVCW61TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.965 Expected Error Rate: 0.0121 Quality Trim Threshold: 14.5