EST details — SGN-E237693

Search information 
Request: 237693Match: SGN-E237693
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C17284Clone name: cLED-19-D19
cartOrder Clone
Library Name: cLEDOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: ovary
Development Stage: 5 days pre-anthesis to 5 days post-anthesis

Microarray: This clone is not found on any microarray
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
No additional reads found.
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E237693Length: 518 bp (817 bp untrimmed)
Status: Current VersionDirection: 5'
>SGN-E237693 [] (trimmed) TGGTGTTGCAGCTCCAGGACATGATGTACGATTACATCATGATCCACAATCAAAGAATTATGTTTTCTCAAATGCTCTTTCAAGCCCTGTTCGGC
AAAGCCTGCAGAATTATCAAGTTGCTCAAGGAGGTTACTTTTCAAACAATGTTCAGCTATCAATTGGAGCAAGAAACAACGAAACCAACCTCCAC
CACCAAAATGGGGATTCCAATAGCTATAACTCAGCTGATGCTGCCATGGATATGCATTCTGATAGCCCTGGTCATGATTTTACTTGCTGAAGTAA
TTTGTATATAGAATGTTTTGGGAGCTGCTTCTTGTCATGCCGTGGTATTCAAGCAGCAAGTTCAGGTTGATTGATTGTCGTGTGTAGCAGCTGTT
GTCAGGGAGAAAATGCCGTTATTGAATTGGGTGTATGATTCAGAGATTGAAAGGTGCGTTCGTGTTGGCTAGTAAATCATCATTCTGTTGACATG
CTCTTAACGTAAAATGCAACGTGATGGGCACAATACTTGCTGA
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E237693] SGN-U570653 Tomato 200607 Build 2 19 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T53607 [Download] [View] Facility Assigned ID: TOVCW22TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read -- flanking 3' vector arm detected.
Passed all screens and filters
Sequence Entropy: 0.964 Expected Error Rate: 0.0114 Quality Trim Threshold: 12.5