EST details — SGN-E237743

Search information 
Request: 237743Match: SGN-E237743
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C17420Clone name: cLED-19-J8
cartOrder Clone
Library Name: cLEDOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: ovary
Development Stage: 5 days pre-anthesis to 5 days post-anthesis

Microarray: Alias clone SGN-C175935 is on microarray TOM1: SGN-S1-1-4.3.11.6
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C175935 [TUS-22-K5] Trace: SGN-T180454 EST: SGN-E367840 Direction: 3' Facility: INRA
Clone: SGN-C175935 [TUS-22-K5] Trace: SGN-T180455 EST: SGN-E367841 Direction: 5' Facility: INRA
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E237743Length: 414 bp (866 bp untrimmed)
Status: Current VersionDirection: 5' [See links to 3' reads above]
>SGN-E237743 [] (trimmed) ACCAAAACAAAAGAGTGTTTGTACTTCCATACTAATAGATATAAAACAAAGGAGTGTTGCTTAACAAAATACTCAAACTATAAAGAAACAAAAGA
GAATTTATCTAAATTAATAAGATTCTAATGCTTTCATCATCCTCCTTCTTAAAAAAAGTAAGTCTTAAATATATCAAGTAAGGTCTTCATCACTA
CTACTTTCATCCCCCTCCTCCTGTTTATCTTCTCAACCTTGATTGTTTTTGCTAGAATATTGATGATTTAACGGTTGCATATCTTCTTGTGGTGG
TTGAGCGCCCAATGAGGTCAATGTGTCTGTATTTAATTGAAGTCCTAGATACATACGCTTTAGTCGTCCAAGAATATCATTTGTAACTTCTTGTT
GTATAGCTTCTTAATGGTGGTCTATTTTTTCAAA
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E237743] SGN-U573310 Tomato 200607 Build 2 8 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T53657 [Download] [View] Facility Assigned ID: TOVCX52TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.928 Expected Error Rate: 0.0118 Quality Trim Threshold: 14.5